Hi, first of all, thank you for all the hard word of building this wonderful module.
I've implemented this module on my local website, following the steps in the Readme.txt file. Everything works fine except coming to the demonstration.
So I downloaded this database, arabidopsis_mRNA_ncbi_base_nr100, provided in the Readme.txt file, and successfully linked it with blastall. Then I used it as the subject and type a segment of query sequence as the following:
>ATMG00090.1 | Symbols: | ribosomal protein S3
ATGGCACGAAAAGGAAATCCGATTTCGGTAAGACTTGGAAAAAATCGTAGTTCAGATTCAAGTCGGTTCAGTGAGTATTA
But when I run the search, it takes forever to show the result, and the result page just kept refreshing and asked me to "wait and try again".

I've also tried this query sequence on the tutorial website, http://insectacentral.org/dbsf/blastall, against a random selected database, and the same thing happened, the result never showed up.

I also tried with another website using the same module, http://aviangenomes.org/bench/blastall, and this time a result page showed up after 3 minutes, and says "No (more) hits found for any of your queries using blastn. Perhaps you can try a different algorithm or database?", which is expected because I'm just blasting with random database.

Besides on running it on different servers, I also ran the blastall command locally with command line, and the result is generated immediately. So I think the command is running all right, but there might be something I've not done right with the configuration of the module.

Would you please look into this and help me out, thank you very much.

CommentFileSizeAuthor
#1 check_daemon.pl_.patch445 bytesalpapan

Comments

alpapan’s picture

StatusFileSize
new445 bytes

Hello

Sorry for the delay, i'm now back in Europe for a bit so some free time to work on this project.
I think one issue is that the BLAST server sometimes crashes without a message (in InsectaCentral.org at least). Also InsectaCentral uses an old version of biosoftware_bench. Please check out the latest release.

A sysadmin should monitor it to see if this is what happened. I use the biosoftware_bench script start_daemon.sh to start the server and the script check_daemon.pl in the crontab to monitor it automatically. Sadly there is a bug in this latter script, a patch for which I've attached here.

let me know how it goes
a

Alexie Papanicolaou
OCE PostDoctoral Fellow in Bioinformatics
CSIRO Ecosystem Sciences
Black Mountain Labs
Clunies Ross St
Canberra ACT 2601
GPO 1700
Australia

alpapan’s picture

Status: Active » Fixed

Status: Fixed » Closed (fixed)

Automatically closed -- issue fixed for 2 weeks with no activity.